a comment on '<$BlogItemTitle$>'">post a comment

Adolph and the Fourth Reich of Rock

"I'm Whittlin' Me a Jew-Beatin' Stick"

Now: 610,050,544

Today: 11,234,455

Unique: 7

Yesterday: 124,343,555,644

Visitors in Persistent Vegetative State: 124,343,555,611

Visitors who bother to read the paper: 3

Give money today so that Little Green Fascists can race bait, buy erection medication, and fight the liberal menace!

Is Chris Matthews really a Communist sympathizer who uses mind-control to advance the homosexual atheist liberal agenda? Read the scathing reports here!

Liberals?

Commies?

Defeatists?

Rejectionists?

Saddamists?

RINOs?

Subscribe in NewsGator Online

Add to Google

Subscribe in podnova

What should we do?

Support Israel
Oppose Hezbollah
Oppose the Palestinians
Bomb Iran
Bomb Syria
Bomb

View Results

Make your own poll

It's in the Bible! Duh!

Visit glittercharm.com for awesome glitter graphics!></a>

<a href=
Web hosting by ICDSoft

Buy Ribbon Magnets! Whatever you do, don't sign up for the military yourself! That demoralizes the troops! Let them know you really care by covering your massive SUV in ribbon magnets! Plus, be sure to buy the ones that come from Communist China. Don't let the Leftist Unions win!

Web hosting by ICDSoft

We are conservative higher order apes from the Rand System. We are not nerdy at all.

Saturday, August 05, 2006

Breaking: Israel Keeps Things Even in Gaza!

Release one; take one. Keeps things even.

RAMALLAH, West Bank - Israeli forces arrested the speaker of the Palestinian parliament at his house in the West Bank early Sunday, and pressed their monthlong offensive in Gaza against Hamas.

About 20 Israeli army vehicles surrounded the house of parliament speaker Abdel Aziz Duaik, a member of Hamas, and took him into custody, the director of the speaker's office and security officers said.

The Israeli military said that as a Hamas leader, he was a target for arrest.

On June 29, Israeli forces in the West Bank rounded up dozens of Hamas officials, including eight Cabinet ministers. One was released earlier this week.

And you know that if they had to use 20 vehicles, that he's one dangerous terrorist. Israel never goes for overkill. Here's his photo:


Looks like my dad. Scary.
Make ein comment?

Comments on "Breaking: Israel Keeps Things Even in Gaza!"

 

Blogger Imad said ... (Saturday, August 05, 2006 9:21:00 PM) : 

The speaker of the house, eh? Well, elected or not elected, they all are responsible for something.

Karl,

Can you use one of own spin machines and invent a word that sounds similar to democracy but it isn't anything like that so we could install that in Palestine to stop Hamas for taking over their parliament again?

Sporty,

Are you sure that you are not Arab? You better get a DNA test and publish the results here so we could trust you again.

 

Blogger Ziegfreid said ... (Sunday, August 06, 2006 12:14:00 AM) : 

Only zwenty vehicles, und nein Flammenwerfers? Ich vant feuer, immens feuer, das is sooo gut, ich libe feuer, groß feuer, außergewöhnlich groß feuer, sorry I get carried away mitt feuer...

by ze vay, ven ist der barbeque?

 

Blogger Carl said ... (Sunday, August 06, 2006 6:08:00 AM) : 

Vy doest your pater look like meining????

 

Blogger Sporty said ... (Sunday, August 06, 2006 7:19:00 AM) : 

Imad,

O.K. Here are the results:

atttttgggggccggatccccccccccttt
gggaaaaatgaccccccgagagttgaaatt
tttaccccaaaaaaccgcgcccccccgggg
taaatatagattaaccccaaaaaaagtttt
ttttccccccccaaatttggtgtgtggaga
tagatagataacacacagacatacatagac
atataatatagacacacatcgcgcgctctc
tcgagagatctctcctaatatagattaacc
caaaaaaagttttaaacccccccccaacac
ttttccccccccaaatttggtgaatatagt
attaaccccaaaaaaagttttaaacacacc
ttttccccccccaaatttggtgaatatacc
gattaaccccaaaaaaagttttaaaatttt
ccccttccccccccaaatttggtgaatatc
ttaaccccaaaaaaagttttaaacacacac
aaaatccccccccaaatttggtgaatatag
ggggggccaaaaaaagggttgattacagat
ttttccccccccaaatccggtgaatataga
aaaacccaatttaaagttctgattacagct
ttttccccccccaaataaggtgaatataga
taaccccaaaaaaagtaaccccccccccac
ttttccccccctttaaaaggtgaatataga
taaccccaaaaaaagttttttttaaaaaaa
ttttcccccttttttttttttaaatttggt
gggggttttttgaataataaggtgaccccc
cccccaataataaggtgaataataattttt
ttttggtgaataatcccccctttttttttt
aaaaggtgaataataaggtgaataaccccc
atattttttaggtgaataataaggtgaata
ccccatacccagccccggggggtgaata...

Email me for the rest!

 

Links to "Breaking: Israel Keeps Things Even in Gaza!"

Create a Link